DNA Profiling

Crime scene investigation shows are wildly popular in the U.S.A. and these shows frequently feature DNA as a key component of their weekly excursions. But how does DNA profiling actually work, and what does it accomplish?

Get your students engaged in the process of analyzing DNA samples with this cool activity from HHMI BioInteractive!

Grade(s): 9-12

Introduction to the Activity

HHMI BioInteractive: DNA Profiling

In this activity, students will learn the basics of DNA profiling and explore fundamental concepts of patterns of inheritance, short tandem repeats, and calculating allele frequency. Students will formally learn about short tandem repeats and their use in forensic science to match DNA samples found on crime scenes to suspects. Students will then be able to apply what they have learned in a case study that involves building a DNA profile.

I’ve been a big fan of HHMI BioInteractive for some time now, and I think they are a great resource for your science classroom.

Conceptual Background

DNA is the foundational blueprint for all life on earth. Through the use of sexual reproduction, the DNA in every individual is entirely unique. Much like a fingerprint, no two individuals have the same DNA sequence (well, except for identical twins). This handy bit of information makes it useful to identify criminals from the genetic clues they leave at the scene of the crime.

One of the ways that forensic scientists create the genetic profile of a suspect is through the use of short tandem repeats, or STR’s. an STR are regions of non-coding DNA that contain repeating sections in the nucleotide sequence. DNA is composed of four base nucleotides: adenine, thymine, guanine, and cytosine. Every individual person has repeating sequences of these nucleotide base pairs that are completely unique to them.

For example, one part of a DNA sequence would contain the pattern CGTAACGATAGATAGATAGATAGATAGATACCGAT, the nucleotide sequence “GATA” repeats six times. The patterns and sequences of these STR’s allow forensic scientists to identify suspects at the crime scene with unparalleled accuracy.

Image result for dna profiling short tandem repeats

 

NGSS Connections

Apply concepts of statistics and probability to explain the variation and distribution of expressed traits in a population.

 

Disciplinary Core Ideas

LS3.B: Variation of Traits

  • Environmental factors also affect the expression of traits, and hence affect the probability of occurrences of traits in a population. Thus the variation and distribution of traits observed depend on both genetic and environmental factors.

 

Advertisements

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out /  Change )

Google photo

You are commenting using your Google account. Log Out /  Change )

Twitter picture

You are commenting using your Twitter account. Log Out /  Change )

Facebook photo

You are commenting using your Facebook account. Log Out /  Change )

Connecting to %s